which is the best hospital of gynecological in jinhua, I want to do a comprehensive women exams!_百度知道
which is the best hospital of gynecological in jinhua, I want to do a comprehensive women exams!
提问者采纳
better go to the govenment website, the information there is more comprehensive !
其他类似问题
等待您来回答
下载知道APP
随时随地咨询
出门在外也不愁Jinhua Ham scam exposed
Jinhua Ham scam exposed
Shanghai Star.
AFTER the famous Taicang Rousong (dried meat fibre) company was found using dead pig's meat to make their pork shreds, CCTV's weekly Quality Report has this week focused its attention on another famous food brand - Jinhua Ham.
Jinhua, a city in Zhejiang Province, has been famous for its ham for more than 1,200 years. Its delicious taste has even won it a good reputation abroad. But it was recently found that some ham manufacturers here were so blinded by greed that they spread dichlorvos, a pesticide, on the ham so that flies would be kept off it.
According to business insiders the temperature in winter, between 0-10 degrees centigrade, is the best season for the production of ham. In other seasons, the ham can easily go bad. But locals thought of a way to expand their production in other seasons by using the pesticide to prevent the meat deteriorating, a method quite popular with small ham producers in Jinhua, the Beijing Message and Entertainment Newspaper reported.
The illegal act of the small producers has already brought great losses to the big ham companies in Jinhua. The largest local ham producer, the only one holding "Jinhua" as its trademark, said that it had always strictly observed the proper processing schedule and hadn't done anything to besmirch its brand. But the pesticide scandal has still seriously affected the company's reputation, along with that of the greedy culprits and even government monitoring agencies, the boss was quoted as saying.
In a related development, a storehouse in Huoyan Village of Changsha in Hunan Province, contained 25 tons of Chinese dates poisoned by vendors who had smoked them with sulfur to make them look shiny, according to the latest reports.
When the Quality Inspection Bureau visited the site to seize the dates and destroy them, half the stocks were found to have already been moved to other places.
The vendor said he had returned the goods to the original seller in North China's Hebei Province. Currently some 50 to 60 businessmen in the city of Changsha are involved in the poisonous Chinese date business.
The city's inspection bureau has dispatched staff to search for the poisonous dates. People can detect poisonous ones by their colour: if they look shiny as if waxed outside, while still being white inside, they are most probably sulfur smoked dates.
Copyright by Shanghai Star.Services on DemandArticleIndicatorsCited by SciELO Related linksSimilars in
SciELO SharePrint version ISSN Genet. Mol. Biol. vol.34 no.1 S?o Paulo
2011 Epub Dec 03, 2010 http://dx.doi.org/10.-00107
Association of PPARγ2 polymorphisms with carcass and meat quality traits in a Pietrain x Jinhua F2 population
Zhe ChenI; Xiaofeng ZhaoII; Xiaoling JiangI; Xiaoling GuoI; Zunzhou LvI; Hongmei ZhouI; Ningying XuI
ICollege of Animal Science, Zhejiang University, Zhejiang Province, P.R. China
IICollege of Life and Environmental Sciences, Hangzhou Normal University, Zhejiang Province, P.R. China
The PPARγ2 gene is a key regulator of both proliferation and preadipocyte differentiation in mammals. Herein its genotype and allele frequencies were analyzed using PCR-SSCP in eight pig breeds (N = 416). Two kinds of polymorphisms of the PPARγ2 gene were detected, including a previously reported shift SNP A177G (Met59Val) in exon 1 and a novel silent mutation G876A in exon 5. The results revealed that European pig breeds carry a higher allele A frequency at the A177G locus and a fixed GG genotype at the G876A locus. Allele A at the G876A locus was only found in Jinhua pigs. The association between haplotype (A177G/G876A) and carcass and meat quality traits was analyzed in a Pietrain x Jinhua F2 population (N = 248). The PPARγ2 gene was found to be significantly associated with backfat thickness at the shoulder (p & 0.05), 6-7th ribs (p & 0.01), last rib (p & 0.01), gluteus medius (p &0.05) and ham weight (p & 0.01). Significant effects of different haplotypes on ham weight and backfat thickness at the 6-7th ribs, last rib, and gluteus medius were also observed.
Key words: PPARγ2 gene, haplotype, carcass and meat quality, pigs.
Introduction
Genetic effects on porcine meat quality have historically been widely recognized and marker-assisted selection has been used by animal breeders to improve the quality and performance of livestock (Van der Steen et al., 2005). Reducing body fat, increasing lean percentage, and improving meat quality are critical issues for the pig breeding industry. Thus, there is great interest in having comprehensive molecular marker information for improvement of do mestic swine.
The peroxisome proliferator-activated receptor-γ (PPARγ ) is a member of the nuclear hormone receptor superfamily. It exists as two distinct isoforms (γ1 and γ2) produced from a single gene sequence by alternative splicing, resulting in amino acid differences in the N-termini (Fajas et al., 1997; Omi et al., 2005). PPARγ1 is expressed in a variety of tissues at a relatively low level, while PPARγ2 is exclusively expressed in adipose tissue and at ten times higher transcriptional activity (Tontonoz et al., 1994a; Werman et al., 1997). PPARγ2 is known as a key regulator of adipogenesis involved in the regulation of fatty acid uptake and storage (Rosen et al., 1999). It participates
in the transcriptional activation of several adipogenic transcription factors and lipogenic genes (Wu et al., 1999; Pasceri et al., 2000; Rosen et al., 2002; Arimura et al., 2004), and directs the differentiation of preadipocytes to
adipocytes. Interestingly, overexpression of PPARγ2 in fibroblast cell lines using retroviral vectors efficiently con-verts them to adipocytes (Tontonoz et al., 1994b). Previous
research also supported this view, indicating a dual role for PPARγ2 in the regulation of both proliferation and preadipocyte differentiation (Fajas et al., 2002; Samulin et al., 2008). Therefore, PPARγ2 appeared to be a promising candidate gene for improving carcass and meat quality traits. However, very little work has yet been conducted to inves tigate the role of the porcine PPARγ2 gene in carcass and meat quality.
Emnett et al. (2000) found a signicant association between the PPARγ2 Met59Val polymorphism, meat quality and backfat thickness in Berkshire, Duroc, Hampshire and
Landrace swine breeds, while Grindflek et al. (2004) found
a significant association between the Met59Val/A220G/
G324A haplotype and ham weight in a Norwegian pig pop ulation, but they did not denote a major effect on backfat thickness.
The current study was designed to detect novel single
nucleotide polymorphisms (SNPs) of the porcine PPARγ2 gene using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and DNA sequencing, and to further investigate the relationship between these SNPs and carcass and meat quality in a Pietrain x Jinhua F2 crossbred population.
Material and Methods
Animal and data collection
The association between the SNPs and recorded traits were analyzed in a Pietrain x Jinhua F2 crossbred swine population. The Pietrain x Jinhua resource population was constructed from purebred Pietrain sires and Jinhua dams, including 6 F1 boars, 20 F1 sows and 248 F2 progeny. The 248 PJF2 offspring were raised under standard conditions at The Experimental Pig Farm of Zhejiang University and slaughtered at a commercial abattoir. In addition, DNA samples of eight pig breeds were collected, consisting of 96 Jinhua, 36 Jiaxing Black, 54 Bihu, 66 Shengxian Hua, 37 Landrace, 67 Yorkshire, 30 Duroc and 30 Pietrain pigs (). The sampled pigs were from sources that were unrelated throughout the last three generations.
PJF2 animals were slaughtered (following electric shock) at 219 days of age (SD = 31.4 days, live weight 81.3 ± 10.58 kg). After slaughter, backfat thickness (BFT) was measured on the left side at four locations (shoulder, 6-7th ribs, last rib, and gluteus medius). At 45 min postmortem, muscle pH and temperature measurements were taken on the longissimus dorsi (LD) muscle using a Thermo Scientific Orion pH meter (Model 230A Plus, USA) and a digital thermometer (Ama-digit 14 TH 35? C-500 ?C Amarell electronic, Kreuzwertheim, Germany), respectively. Loin eye area (LEA) of the LD muscle was traced on an acetate film between the 13/14th ribs and quantitated by planimetry. Samples of the longissimus dorsi muscle were taken at the 13th rib for the determination of water-holding capacity (WHC), intramuscular fat (IMF), protein (IMP) and water (IMW) content. WHC was determined with the filter paper press method (Wierbicki and Deatherage, 1958), while intramuscular fat, protein and water content were determined using a Meat Analyzer (Antaris II FT-NIR analyzer, Thermo Electric company, USA). Additionally, the ham was cut from the last lumbar vertebra and the feet were removed.
Primers, amplification conditions and PCR-SSCP analysis
Two pairs of primers were designed based on the porcine PPARγ2 gene mRNA sequence (GenBank, accession number NM_214379) and human PPARγ2 gene chromosomal sequence (GenBank, accession number NC_000003). For amplification of the PPARy2 gene, the PPARγ2 -P1 primer (5' TGACACCGAGATGCCGTT 3' and 5' TGGAGCTTCAGGTCGTACTT 3') were used. This primer combination generates a 204 base pair (bp) amplicon from exon 1. The second primer pair named PPARγ2 -P2 (5'CTTGCAGCCATTTGTCATC3' and 5'AGGGCTTTCTCAGGCTCTT3') amplifies a 350 bp fragment from exon 5.
PCR amplifications were carried out in 25 µL reaction volumes containing at the following final concentrations: 50 ng of template DNA, 400 µ M of dNTPs (Sangon, China), 0.25 µ M of each primer and 1 unit (U) of Taq polymerase (TaKaRa, Japan). The PCR protocol consisted of an initial denaturation at 94 ?C for 5 min, followed by 36 cycles of denaturation at 94 ?C for 30 s,
annealing at 55 ?C for PPARγ2 -P1 or 51 ?C for PPARγ2 -P2 for 30 s, and extension at 72 ?C for 30 s, with a final extension at 72 ?C for 10 min.
The porcine PPARγ2 alleles were detected using PCR-SSCP. A 5 µ L aliquot of each amplicon was diluted in denaturing solution (98% formamide, 10 mM EDTA, 0.025% bromophenol blue, 0.025% xylene-cyanol) denatured at 95 ?C for 5 min, rapidly cooled on ice and resolved in acrylamide:bisacrylamide (29:1) (Bio-Rad) gels at 400 V for 4 h at 4 ?C, in 1 x TBE buffer (89 mM Tris base, 89 mM boric acid, 2 mM EDTA, pH 8.0). The gels were silver-stained according to the method of Bassam et al. (1991).
Sequence analysis
Nucleotide sequence translation and comparisons were carried out using the DNAMAN software. The BLAST algorithm of NCBI was used to search homologous sequences in the NCBI GenBank database.
Statistical analysis
Linkage disequilibria between all pairs of biallelic loci were calculated using measures of Lewontin's D' and r2 (Pritchard and Przeworski, 2001) in the PJF2 population. Haplotypes were determined by the Linkage algorithm of the HaploView software (V 2.01). The genotype and allele distributions in purebreds were tested for Hardy-Weinberg equilibrium using the χ2 test.
For studying the association between the PPARγ2 gene haplotypes and recorded traits in the PJF2 crossbred animals, the following model was used:
Yijklm= µ + Si+ Fj+ Gk+ ll+ β * Xijklm+ eijklm
where Yijklmis the obse µ is Si is the Fj is the fixed
Gkis the fixed effect of the kth
ll is the ran β is the regression coefficient of
Xijklmis the slaughter weight as covariate, and eijklmis the random residual error. The least square means method of the GLM (General Linear Model) procedure (SPSS 16.0) was used for association analysis between the PPARγ2 haplotypes and recorded traits.
Detection of single nucleotide polymorphisms
Two fragments, PPARγ2-P1 (204 bp) and PPARγ2 -P2 (350 bp) were amplified from genomic DNA. These were then assayed by the SSCP technique and products with unique patterns were sequenced to detect any single base substitution. One substitution located in exon 1 at position 177 (c.+177A&G, GenBank accession No. NM_214379) causes an amino acid change from methionine to valine (Met59Val). This SNP has already been described in previous studies (Emnett et al., 2000; Grindflek et al., 2004). The primer PPARγ2 -P2 detected a novel polymorphism in exon 5 at position 876 (c.+876G&A,GenBank accession No. NM_214379) of the porcine PPARγ2 gene. This SNP represents a silent mutation.
Genotype frequencies in different pig populations
The combined effects of the exon 1 and exon 5 substitutions were estimated as haplotype substitution effects. Genotype and allele frequencies of the SNPs A177G and G876A within pure breeds are shown in .
At A177G, allele A had a high frequency (& 75%) in European pig breeds, especially fixed in Pietrain swine, and a relatively lower frequency in Chinese native breeds (& 67%). In Jinhua, Jiaxing Black, Landrace and Yorkshire breeds, the alleles were at Hardy-Weinberg equilibrium. Interestingly, at G876A, allele A was found only in Jinhua pigs, whereas allele G was fixed in all other breeds. Therefore, allele A appears to be Jinhua-specific, and, consequently, the breeds were not at Hardy-Weinberg equilibrium with respect to this marker.
Haplotype analysis
Four haplotypes, H1 (A-G), H2 (A-A), H3 (G-G), and H4 (G-A), were found in PJF2 animals and had their frequencies and linkage disequilibria estimated (). Of the four types, the A-G haplotype (H1) was found to represent the majority. Linkage analysis indicated that there were certain linkage disequilibria between the two SNPs A177G and G876A (D' = 0.504).
Relationship between PPARγ2 gene haplotypes and recorded traits
The results of the association analysis of PPARγ2 gene haplotypes and recorded carcass and meat traits within the PJF2 population are shown in . PPARγ2 gene haplotypes were found to be significantly associated with BFT at the shoulder and gluteus medius (p = 0.029 and 0.042, respectively), with significant effects observed on ham weight and BFT at the 6-7th ribs and last rib (p = 0.000, 0.003, and 0.003, respectively). Pigs with the H1H3 genotype had lower ham weight compared to the other genotypes (p & 0.01). H2H3 genotype pigs had higher BFT at the 6-7th ribs, last rib and gluteus medius (p & 0.01), while for BFT at the shoulder, the H2H3 genotype had relatively higher thickness, just slightly lower than that of the H1H3 genotype.
Discussion
The Jinhua and Pietrain breeds are significantly different in carcass and meat quality phenotypes. As a Chinese domesticated breed, the Jinhua pig has a reputation for its thin skin, fine bones and tender meat, but has higher BFT and IMF content than other breeds. In contrast, the Pietrain type, which has a relatively lower BFT and IMF content, is famous for its high quality and high proportion of lean meat vs. fat content, and has been used worldwide as a sire breed. Observed differences in carcass and meat quality phenotypes are probably related to protein accretion and lipid synthesis (Renaudeau and Mourot, 2007). In this regard, it has been suggested that certain genes may play important physiological roles in fat-related pathways (Agarwal and Garg, 2006). Therefore we hypothesized that fat-related genes that are at considerable linkage disequilibrium may produce distinct phenotypes in a Pietrain x Jinhua F2 (PJF2) population. In this study, we found that genotype and allele frequencies for two analyzed polymorphisms differed between the Chinese native pig and the European pig, indicating that the two types of breeds had been subject to different genetic selection regimes.
Lai et al. (2008) demonstrated that the region of the PPARγ2 promoter comprising nucleotide base pair positions -457 to +129 is essential for the CEBPD (CCAAT/Enhancer binding protein D) response which activates PPARγ2 transcription. They furthermore suggested that the A177G SNP might affect binding efficiency and thus the gene expression level at this site. Although the G876A SNP is a silent mutation, there is substantial evidence indicating that silent mutations may affect mRNA secondary structure and stability (Shen et al., 1999; Duan et al., 2003), mRNA decay rates, and ultimately lead to disease (Capon et al., 2004).
The porcine PPARγ2 gene was mapped to chromosome 13 (Grindflek et al., 2000) and found to be close to several quantitative trait loci (QTL) and candidate genes for birth weight, daily weight gain and BFT (Andersson et al., 1994; Yu et al., 1995; Evans et al., 2003). Since it plays a key role in proliferation and preadipocyte differentiation, PPARγ2 is an excellent target for studying growth and fat deposition traits. Experiments with homologous PPARγ2 deficient mice showed that genetic ablation of PPARγ2 decreased adipose tissue expandability and the capacity for buffering toxic lipids in peripheral organs (Medina-Gomez et al., 2007). In humans, several SNPs within the PPARγ2 locus (Pro12Ala, C1431T, C2821T, A2819G) have been identified in different populations, and their alleles demonstrated to be associated with obesity, type 2 diabetes, increased insulin sensitivity and decreased receptor activity (Deeb et al., 1998; Gonz&lez S&nchez et al., 2002; Meirhaeghe and Amouyel, 2004; Costa et al., 2009).
A total of five mutations have previously been identified in the porcine PPARγ2 gene promoter and coding regions, these being A177G (M59V), G78A, A42G, A220G and G324A (Emnett et al., 2000; Grindflek et al., 2004). In our study we identified a novel Jinhua-specific SNP (A876G), as well as the previously reported A177G (M59V) polymorphism, and investigated haplotype effects in a PJF2 population.
Haplotypes can be used to correlate a specific phenotype with a specific gene in a small sample population (Drysdale et al., 2000) and can provide more information on the complex relationship between DNA variation and phenotype than single SNPs may afford (Stephens et al., 2001). Thus, we used haplotype information to evaluate the relationship between PPARγ2 polymorphisms and candidate traits in swine. Our results showed significant effects on ham weight (p & 0.01), consistent with previous results obtained by Grindflek et al. (2004). We also found in the PJF2 population significant differences between the different haplotypes with respect to BFT at the 6-7th ribs (p & 0.01), the last rib (p & 0.01) and the gluteus medius (p & 0.01). No significant association was found between haplotypes and IMF.
Grant et al. (2008) first reported that exposure to the PPARy agonist troglitazone (TRO) resulted in a 6.4-fold increase in the percentage of differentiated subcutaneous preadipocytes compared to intramuscular preadipocytes, and they conjectured that inherent differences in the capacity for adipose differentiation may exist between bovine subcutaneous and intramuscular preadipocytes. Thus, PPARγ2 gene regulation is thought to favor subcutaneous fat deposition over intramuscular fat content.
The association observed in our study may arise from linkage between the PPARγ2 gene and specific polymorphisms that are in linkage disequilibrium and may be located in another region of the PPARγ2 gene, or by interaction with other quantitative trait loci. Furthermore, the linkage disequilibrium between A177G and G876A in the PJF2 population was unstable (r2 = 0.249). Consequently, additional studies are needed to better assess the real impact of the effects of the PPARγ2 gene on carcass and meat quality traits.
Acknowledgments
This work was supported by grants from the National Major Basic Research Program of China (973 Program, No. ) and the National High Technology Research and Development Program of China (863 program, No. ).
References
Agarwal AK and Garg A (2006) Genetic disorders of adipose tissue development, differentiation, and death. Annu Rev Genomics Hum Genet 7:175-199.
&&&&&&&&[  ]
Andersson L, Haley CS, Ellegren H, Knott SA, Johansson M, Andersson K, Andersson-Eklund L, Edfors-Lilja I, Fredholm MA, Hansson I, et al. (1994) Genetic mapping of quantitative trait loci for growth and fatness in pigs. Science 263:.
&&&&&&&&[  ]
Arimura N, Horiba T, Imagawa M, Shimizu M and Sato R (2004) The peroxisome proliferator-activated receptor gamma regulates expression of the perilipin gene in adipocytes. J Biol Chem 279:.
&&&&&&&&[  ]
Bassam BJ, Caetano-Anoll&s G and Gresshoff PM (1991) Fast and sensitive silver staining of DNA in polyacrylamide gels. Anal Biochem 196:80-83.
&&&&&&&&[  ]
Capon F, Allen MH, Ameen M, Burden AD, Tillman D, Barker JN and Trembath RC (2004) A synonymous SNP of the corneodesmosin gene leads to increased mRNA stability and demonstrates association with psoriasis across diverse ethnic groups. Hum Mol Genet 13:.
&&&&&&&&[  ]
Costa V, Casamassimi A, Esposito K, Villani A, Capone M, Iannella R, Schisano B, Ciotola M, Di Palo C, Corrado FC, et al. (2009) Characterization of a novel polymorphism in PPARG regulatory region associated with type 2 diabetes and diabetic retinopathy in Italy. J Biomed Biotechnol, Epub.
&&&&&&&&[  ]
Deeb SS, Fajas L, Nemoto M, Pihlajam&ki J, Mykk&nen L, Kuusisto J, Laakso M, Fujimoto W and Auwerx J (1998) A Pro12Ala substitution in PPARgamma2 associated with decreased receptor activity, lower body mass index and improved insulin sensitivity. Nat Genet 20:284-287.
&&&&&&&&[  ]
Drysdale CM, McGraw DW, Stack CB, Stephens JC, Judson RS, Nandabalan K, Arnold K, Ruano G and Liggett SB (2000) Complex promoter and coding region β2-adrenergic receptor haplotypes alter receptor expression and predict in vivo responsiveness. Proc Natl Acad Sci USA 97:.
&&&&&&&&[  ]
Duan J, Wainwright MS, Comeron JM, Saitou N, Sanders AR, Gelernter J and Gejman PV (2003) Synonymous mutations in the human dopamine receptor D2 (DRD2) affect mRNA stability and synthesis of the receptor. Hum Mol Genet 12:205-216.
&&&&&&&&[  ]
Emnett RS, Grindek E, Rothschild MF, Moeller SJ, Meeker DL and Irvin KM (2000) The effects of porcine peroxisome proliferators-activated receptor gamma (PPARG) in Berkshire, Duroc, Hampshire and Landrace breeds. Proceedings of the International Plant & Animal Genome Conference, San Diego, VIII P396. .
&&&&&&&&[  ]
Evans GJ, Giuffra E, Sanchez A, Kerje S, Davalos G, Vidal O, III&n S, Noguera JL, Varona L, Velander I, et al. (2003) Identification of quantitative traits loci for production traits in commercial pig population. Genetics 164:621-627.
&&&&&&&&[  ]
Fajas L, Auboeuf D, Rasp& E, Schoonjans K, Lefebvre AM, Saladin R, Najib J, Laville M, Fruchart JC, Deeb S, et al. (1997) The organization, promoter analysis and expression of the human PPARgamma gene. J Biol Chem 272:.
&&&&&&&&[  ]
Fajas L, Landsberg RL, Huss-Garcia Y, Sardet C, Lees JA and Auwerx J (2002) E2Fs regulate adipocyte differentiation. Dev Cell 3:39-49.
&&&&&&&&[  ]
Gonz&lez S&nchez JL, Serrano R&os M, Fern&ndez Perez C, Laakso M and Mart&nez Larrad MT (2002) Effect of the Pro12Ala polymorphism of the peroxisome proliferators activated receptor gamma-2 gene on adiposity, insulin sensitivity and lipid prole in the Spanish population. Eur J Endocrinol 147:495-501.
&&&&&&&&[  ]
Grant AC, Ortiz-Col&n G, Doumit ME, Tempelman RJ and Buskirk DD (2008) Differentiation of bovine intramuscular and subcutaneous stromal-vascular cells exposed to dexamethasone and troglitazone. J Anim Sci 86:.
&&&&&&&&[  ]
Grindek E, Sundvold H, Lien S and Rothschild MF (2000) Physical and genetic mapping of the peroxisome proliferators receptor y (PPARy) gene to porcine chromosome 13. J Anim Sci 78:.
&&&&&&&&[  ]
Grindflek E, Hoen N, Sundvold H, Rothschild MF, Plastow G and Lien S (2004) Investigation of a peroxisome proliferatoractivated receptor gamma haplotype effect on meat quality and carcass traits in pigs. Anim Genet 35:238-241.
&&&&&&&&[  ]
Lai PH, Wang WL, Ko CY, Lee YC, Yang WM, Shen TW, Chang WC and Wang JM (2008) HDAC1/HDAC3 modulates PPARG2 transcription through the sumoylated CEBPD in hepatic lipogenesis. Biochim Biophys Acta 14.
&&&&&&&&[  ]
Meirhaeghe A and Amouyel P (2004) Impact of genetic variation of PPARy in humans. Mol Genet Metab 83:93-102.
&&&&&&&&[  ]
Medina-Gomez G, Gray SL, Yetukuri L, Shimomura K, Virtue S, Campbell M, Curtis RK, Jimenez-Linan M, Blount M, Yeo GS, et al. (2007) PPAR gamma 2 prevents lipotoxicity by controlling adipose tissue expandability and peripheral lipid metabolism. PLoS Genet 3:e64.
&&&&&&&&[  ]
Omi T, Brenig B, Spilar Kramer S, Iwamoto S, Stranzinger G and Neuenschwander S (2005) Identification and characterization of novel peroxisome proliferator-activated receptorgamma (PPAR-y) transcriptional variants in pig and human. J Anim Breed Genet 122:45-53.
&&&&&&&&[  ]
Pasceri V, Wu HD, Willerson JT and Yeh ET (2000) Modulation of vascular inammation in vitro and in vivo by peroxisome proliferator-activated receptor-gamma activators. Circulation 101:235-238.
&&&&&&&&[  ]
Pritchard JK and Przeworski M (2001) Linkage disequilibrium in humans: Models and data. Am J Hum Genet 69:1-14.
&&&&&&&&[  ]
Renaudeau D and Mourot J (2007) A comparison of carcass and meat quality characteristics of Creole and Large White pigs slaughtered at 90 kg BW. Meat Sci 76:165-171.
&&&&&&&&[  ]
Rosen ED, Sarraf P, Troy AE, Bradwin G, Moore K, Milstone DS, Spiegelman BM and Mortensen RM (1999) PPAR gamma is required for the differentiation of adipose tissue in vivo and in vitro. Mol Cell 4:611-617.
&&&&&&&&[  ]
Rosen ED, Hsu CH, Wang X, Sakai S, Freeman MW, Gonzalez FJ and Spiegelman BM (2002) C/EBPalpha induces adipogenesis through PPARgamma: A unied pathway. Genes Dev 16:22-26.
&&&&&&&&[  ]
Samulin J, Berget I, Lien S and Sundvold H (2008) Differential gene expression of fatty acid binding proteins during porcine adipogenesis. Comp Biochem Physiol B Biochem Mol Biol 151:147-152.
&&&&&&&&[  ]
Shen LX, Basilion JP and Stanton Jr VP (1999) Single-nucleotide polymorphisms can cause different structural folds of mRNA. Proc Natl Acad Sci USA 96:.
&&&&&&&&[  ]
Stephens JC, Schneider JA, Tanguay DA, Choi J, Acharya T, Stanley SE, Jiang R, Messer CJ, Chew A, Han JH, et al. (2001) Haplotype variation and linkage disequilibrium in 313 human genes. Science 293:489-493.
&&&&&&&&[  ]
Tontonoz P, Hu E, Graves RA, Budavari AI and Spiegelman BM (1994a) mPPAR gamma 2: Tissue-specic regulator of an adipocyte enhancer. Genes Dev 8:.
&&&&&&&&[  ]
Tontonoz P, Hu E and Spiegelman BM (1994b) Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipidactivated transcription factor. Cell 79:.
&&&&&&&&[  ]
Van der Steen HAM, Prall GFW and Plastow GS (2005) Application of genomics to the pork industry. J Anim Sci 83:E1-E8.
&&&&&&&&[  ]
Werman A, Hollenberg A, Solanes G, Bj&rb&k C, Vidal-Puig AJ and Flier JS (1997) Ligand-independent activation domain in the N terminus of peroxisome proliferator-activated receptor y (PPARy). Differential activity of PPARy1 and -2 isoforms and inuence of insulin. J Biol Chem 272:.
&&&&&&&&[  ]
Wierbicki E and Deatherage FE (1958) Water content of meats, determination of water-holding capacity of fresh meats. J Agric Food Chem 6:387-392.
&&&&&&&&[  ]
Wu Z, Rosen ED, Brun R, Hauser S, Adelmant G, Troy AE, McKeon C, Darlington GJ and Spiegelman BM (1999) Cross-regulation of C/EBP alpha and PPAR gamma controls the transcriptional pathway of adipogenesis and insulin sensitivity. Mol Cell 3:151-158.
&&&&&&&&[  ]
Yu TP, Tuggle CK, Schmitz CB and Rothschild MF (1995) Association of PIT1 polymorphisms with growth and carcass traits in pigs. J Anim Sci 73:.
&&&&&&&&[  ]
Send correspondence to:
Ningying Xu
College of Animal Science, Zhejiang University
310029 Hangzhou, Zhejiang Province, P.R. China
Received: April 23, 2010; Accepted: October 20, 2010.
Associate Editor: Alexandre Rodrigues Caetano
License information: This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.}